DC900100

Overview
NameDC900100
Unique NameDC900100
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length472
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900100 VSS Citrus sinensis cDNA clone VS27V16 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900100 ID=DC900100|Name=DC900100|organism=Citrus sinensis|type=EST|length=472bp
ACTGAAAAATGGGAAAGGCTTCATTGAAGATTTCTCTCTTGCTCTTTGTG
CTCTTTGCCTCGGCTATGATTCCATTCTTGGCAATACCTGGAGCTGAAGC
AAGCAGGGTTCCAACTTCCAAGTCCTTGTTCGGACTGCAGCATAACTTGC
AAGGGCTCCCTAGCCGCTGTGTTGATGGCAAGTGCACTTGTGGCGATACC
CGGCCACTCGATACAGCCGGCGAACCGCAACCAATAGATGCAGCCGGCGA
ACCACAGCCAATGGATGCAGCCGGCGAACCGGAGCCAATAGATACAGCCG
GCGAACCGGAGCCAGTAGATGCAGCCGGCGAACCGCAACCAGTAGATGCA
GCCGGCGAACCGGATCAGCACAAAAGATTTGAAAATCGTCTGATTATCAA
AAAAATTAAATAATGTTCACTGGTCTTTTATCTTTGGAAGTAATGTCCGG
TAACAATTAGTAAATTGGCTCT
back to top