CN185899

Overview
NameCN185899
Unique NameCN185899
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length429
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12622 contig Csv1_Contig12622:126..554. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0002A14_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002A14, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185899 ID=CN185899|Name=CN185899|organism=Citrus sinensis|type=EST|length=429bp
TTTTTTTGCAGAAAGAAATCTCTGCTATATAGTTGATTGTTTATAAGACC
ATTATGGCGATCAGAATCTAATTTGCACAAAGTAAAATTGCCATCACAGT
GCTATTCACATCCTGTATTTTACAAAGAAGATCTCCATCCGTATAAAATG
GTAGTTCATTTGTTTCACAAAGCCCTCTGCACATTTCGTAGCTCTTTCAT
GAAGGAATTATCAACCCTTTTTGAAAGCATGGACGTGACTGCATGCGCAA
CATCCTCATGTTGCCTCTTCTTGATTCAGTAACTTTCATCTCCAGAATCC
TATTGACCAGCATCTTCAGGGAACCTCGCATCAAAAGGAACAGAAGGATG
TGCATGCGCTGAACTACCACCAGTTCCACCATGCTGCAACTCAATGACAA
GCCACCGAACAGCTTTACTCGGTCTGCCT
back to top