CN185894

Overview
NameCN185894
Unique NameCN185894
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length719
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN185894_ssr17 microsatellite CN185894_ssr17:17..30. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig13053 contig Csv1_Contig13053:439..1157. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0002A11_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185894 ID=CN185894|Name=CN185894|organism=Citrus sinensis|type=EST|length=719bp
GCGTTTCACATCTATTTCTCTCTCTCTCTCTTCCCCCCCCCCCCTCCCCC
TCAGAGGCATTTTCACGAACGCATCACAAACATTTTATTCTTTTTTCAAA
ATGGCGAAAGGTGGCAAGCTGATGAAGCTCAAGTCAGTTCTGAAGAAGCT
CAACTCATTCAACAAACAAAACGGCATCGGCGGAGGAAGCTGCAGGCCCG
GCATGAGCTCCGCAGTGGCCGCCGCGGACGATTCCTCCGCCAACTACTCG
GGTGATCTTCACCCCGTTTACGTGGGAAAGTCCCGGAGACGATACCTCGT
CAGCTCAGACATCATCGACCACCCACTCTTCAAAGAGCTCGCCGAACGCT
CCAGCGACTCGTCAGACGCCGTCCACGTGTCCTGCGAGGTCGTCTTGTTC
GAGCACTTGCTTTGGATGCTCGAAAATGCAGATCCCCAGCCGGAGTCTTT
AGATGAACTCGTTGAGTTCTACGCTTGTTAACTGCTCGCTCTCAAGCTCA
AGGGTGCATGGTAATATTAAATTGGTGGCGTGGGGTGGGGTGATTCTGTG
AGGTCACCTGCATGGTAAGAAAAAAGAAAATCGCTGTAAATGATGTAATT
GTAATAATAATGATATGATTAGCGGTGTACTTATAGATGATAAAAGATAC
ATAGTAGAGAGTGGATGAACGGTGAGGAATTAACCCATGTATTTTTACAC
CGGCTAATCGCTAGGCCTG
back to top