DC900082

Overview
NameDC900082
Unique NameDC900082
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length661
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11941 contig Csv1_Contig11941:12..672. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionDC900082 VSS Citrus sinensis cDNA clone VS27Q89 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900082 ID=DC900082|Name=DC900082|organism=Citrus sinensis|type=EST|length=661bp
CTGATTTCGATCTATTTGTCTGCAAATCTTCTCATAGTTATATCACCAAA
GGAAAACGAAAAATGTCTGGCTGTGGTGGAAACTGTGGCTGTGGTTCTAG
CTGCAAGTGCGGCGGCGGCTGCGGCGGTAGCTCCATGTACCCTGACTTGA
GATCCTTTGAGAGCACCACCGTAGCCACCGAGACCCTCGTCCTCGGTGTT
GCTCCTGTCAAGATGCACTCTGAGGGGTCCGAGATGGGATTCGGAGCCGA
GGGCGGCTGCGGCTGCAAGTGTGGACCAAACTGCAAGTGCGACCCTTGTA
ACTGTTAATGAAGACTACGAGACGTGAACATGCCCCAGAATAAAGCAGCG
CTGTGAGGTCGTTTAAATTATAGTATCAATAAAAAGAACTATTTATCGTT
TGTGGTTGGCTTTGTTGGATGTCGTTTTATGAGCTTTTGTTTGTAAAATA
AAAACCAGCCATGGCTGCTTCTCCGAATCCTTAACTGGGTCTGTTGCAGA
TCCATGGCTAGTTAATTAATCATTAAGTGTCTCTGTGACTTTGTGTACGA
GCGTATCTGTTACTGCTGCTATTCTAATGGGAAGCTTCCTCTCAGACTTT
TATCTATATTGTAAAATGTGTTTGGTTTATGTACTGTATAATAAATTTAC
AACGTTGATTT
back to top