CN185893

Overview
NameCN185893
Unique NameCN185893
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length734
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN185893_ssr80 microsatellite CN185893_ssr80:80..91. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig13053 contig Csv1_Contig13053:309..1042. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0002A11_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185893 ID=CN185893|Name=CN185893|organism=Citrus sinensis|type=EST|length=734bp
TTTTTTTTTTTTTTTTTAAAAATCCCCTCACAATTATATTAATTTAATTA
ATGGGAAAAAAGAAAGAACAATGAATACCTAAATAAATAAAAACAATAGA
TCAATGATTTGATCTCCCTCGGTCTCTCACCAGGCCTAGCGATTAGCCGG
GGGAAAAATACATGGGTTAATTCCTCACCGTTCATCCACTCTCTACTATG
TATCTTTTATCATCTATAAGTACCCCGCTAATCATATCATTATTATTACA
ATTACATCATTTACAGCGATTTTCTTTTTTCTTACCATGCAGGGGACCTC
ACAAAATCACCCCACCCCACGCCACCAATTTAATATTACCATGCACCCTT
GAGCTTGAGAGCGAGCAGTTAACAAGCGTAAAACTCAACGAGTTCATCTA
AAGACTCCGGGTGGGGATCTGCATTTTCGAGCATCCAAAGCAAGTGCTCG
AACAAAACGACCTCCCAGGACACGTGGACGGCGTCTGACAAGTCCCTGGA
GCGTTCGGCGAGCTCTTTGAAAAGTGGGGGGTCGATGATGTCTGAACTGA
CAAGGTATCGTCTCCGGGACTTTCCCACGTAAACGGGGTGAAAATCACCC
GAGTAGTTGGGGGAGGAATCGTCCGCGGGGGCCACTGCGGAGCTCATGCC
GGGCCTGCAGCTTCCTCCGCCAATGCCGTTTTGTTTGTTGAATGAGTTGA
GCTTCTTCAGAACTGACTTGAGCTTCATCAGCTT
back to top