CN185864

Overview
NameCN185864
Unique NameCN185864
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length763
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2508 contig Csv1_Contig2508:1095..1864. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0001P20_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001P20, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185864 ID=CN185864; Name=CN185864; organism=Citrus sinensis; type=EST; length=763bp
GGGGGGGGGGCGGGGGGGAGGGCGGGCCCCCTTTTTTTTAGTTTTAATAA
TAATACATTTCATATCCATGTTCATTTATCATCCTGCGGGAAGACAAAAT
CTATGGGTAAAAACCAACACCCAGACACAATCATAAATCAAACCCTACGT
CATCAGCTCATCCTCTTGTTTATCTTTATCTGCAGGAGTGAGGAAAAAGA
TTTTTAAAAAAATTAAAAATTAAAAACCAAATAAAATCTATCCAGCAATC
ATTTTTCGTCTCTAGAATCAATCATGATCGTCGGAAAATTGTTGGTAGCT
CTTAATCACAGGCAGCACTGAACAATTCCTTTAAGCATTCATTGAAGGAT
TAATTCTCCACTTCATCGTCTCGGAGCATCTCTTGGTAGCGGCATTCTTG
ACTGCAAAAAGCTTTCTCACCTCTGTAAATGTAAATGTCATTTGTCTGTT
CAAGATTCCTCTTGCAAGTGTAGCAAAAGCTGAGGAAATTCTCAGGGGTA
GAGTGGGACTCATTAATACCTGAATCTGATACAGAACAGTAGCTCTCTAT
AATGCAGTTATCAAAAATACGGGTAGTTTTGGGATTTGGCCCATGAGCTA
TCACACATGTATATTCCTCGGAAAGCTCCATTTCAGTCGGAGACAGACAC
TCTGTGCAATTAATAACCTTGGCAGGAGGATCCTTTGTAATTTGGGTGGC
AGAATTAGCTGACCCAGATGGAGAAAGATGAAGAGAGGGAGCAGCTGGCA
ACAGAGAAGGAAT
back to top