DC900053

Overview
NameDC900053
Unique NameDC900053
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length197
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900053_ssr131 microsatellite DC900053_ssr131:131..166.
Csv1_Contig1576 contig Csv1_Contig1576:838..1034. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900053 VSS Citrus sinensis cDNA clone VS27Q60 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900053 ID=DC900053|Name=DC900053|organism=Citrus sinensis|type=EST|length=197bp
CGCTTACGTCACGTCGGGGTTGCAGTTGTGGGTTCCAAAGAGGGTCGTTT
CGCTGCTTAAGAGTTTGATGGATGGTGTGATGAGAGTCAAGTCATTACAT
GTGTGAATTTAATTATCTCTAGGATTTGAGTAATAATAATAATAATAATA
ATAATAATAATAATAATATTTGAATAATTTTCATCTTTCTTTGTTTT
back to top