DC900043

Overview
NameDC900043
Unique NameDC900043
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length213
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900043 VSS Citrus sinensis cDNA clone VS27Q50 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900043 ID=DC900043|Name=DC900043|organism=Citrus sinensis|type=EST|length=213bp
GTGGCCCTTCCCTTGATCCCAATGAGCCTGCTGATGAACACTACCGCCTG
CTCCAATAATATATGTTCTGATAACAGAAGAAATTAAGCAGTTTCTAAGG
CTGCGTTTGTGATTGAAATTGAATAGTTGTAGCTTAAAAGTTACAGCATT
AAAGTGTTTGGTAAACATTAACTTATTTAGTTTGGAAGTTATATTAATAT
GATTTTTTACTTG
back to top