DC900040

Overview
NameDC900040
Unique NameDC900040
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length636
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8354 contig Csv1_Contig8354:155..789. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900040 VSS Citrus sinensis cDNA clone VS27Q48 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900040 ID=DC900040|Name=DC900040|organism=Citrus sinensis|type=EST|length=636bp
CGGCACGAGGGAGCTTTAAGTGGTTCGGCACAGGCTGCTCTGGCTCTAAC
TAACTACCAGAATCTGCTTATGAGGCAGAACTCAATAAATTCAAACCCTA
ACTCGCTTCAACAGGAGGCGTCACCTTCATTTAGTAATTCTAACCAGAGT
CCATCTTCAAGCTTCCAAGGGCCTGCATCTTTCATACCAGGTTCCATGCA
GAACTTGCCTGTTAGTGGCTTCTCTAGTCCCCATTTACCTCCGCAACAAC
CACAGCAACTGCAACAGCGCTCACTGAGTGGAAATAACCTGCTCCAACAG
AGCCATCCACAATCTTCTCAAGGTAATCAGGCAATGCAGCAGCAGATGAT
CCAGCAACTGCTGCAGGAAATGTCTAATAACAATGGAGGAGTGCAACAGC
AGTCCCTTTCTGGACAGGCAAATGGAATGATGGTAAGGAATGGGTTAGGT
TTCGGAGGCAACTCTCCGGCAGCAGGTGCACCTNCAGCTTCAGCTCCGTC
CACCTCCAATGTATCAGGAGGCGGGGTGGCAGGNCCCTACAACAGGCCGG
AGCAACAGTTTCAAAGCTGCTACTAACAGNGAGGCGTCTGCTCCAGCTGG
CATTAATGGATTAATCAGAGAGCCCAAGATTTGCGC
back to top