DC900022

Overview
NameDC900022
Unique NameDC900022
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length579
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8377 contig Csv1_Contig8377:276..854. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900022 VSS Citrus sinensis cDNA clone VS27Q31 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900022 ID=DC900022|Name=DC900022|organism=Citrus sinensis|type=EST|length=579bp
CTCGTGCCGAATTCGGCACGAGCCACAACAAGGCTACCCGCCAGCTGGGT
ACCCGCCACCGGGGGGTTATCCCCCACCCGGTGGATACCCGCCATCCGGT
TACCCACATGGTGCTCATCCTGGCCCCTCAGCTCCACATCATTCAGGACA
CGGTGGTGGTGTTGCCGGAATGATAGCCGGAGGTGCAGCTGCAGCTGCAG
CAGCTCTTGGTGCTCACCACGTGTCACATGGTGCCCACAACATGGGGTAT
GGTGCCCCCCACATGGGGTATGGTGGTATGCATCATGGAGGCAAGTTCAA
GCATGGCAAGCATGGGAAATTCAAGCACGGGAAGCATGGAGGCAAATACA
AGCGTGGGAAGCACGGACATGGAATGTTCGGAGGTGGAAAGAACAGGAAA
TGGAAGTGAGTTTTGTGTATCAACTGGGTTCAGAGCTCTGACTCTACAAA
ATACTGGTTTATGTTTTTCTTGAATAATCTGCACATTTTTATGATGTCTG
GAAGTAGACTTTGTAGGATGTGTTTTGTTTGACACTTTGGCTTTGACATA
TATATAAATACAAGCTGCCTTACGGCATT
back to top