DC900004

Overview
NameDC900004
Unique NameDC900004
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length584
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5631 contig Csv1_Contig5631:1..584. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900004 VSS Citrus sinensis cDNA clone VS27Q14 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900004 ID=DC900004|Name=DC900004|organism=Citrus sinensis|type=EST|length=584bp
AAACAAACGAACAAACATTCAATAACTTCGCTGCCCGAGNAAAAACAAAA
GACAAAAGGTCTGTAATACGAGCAAGAAGAAGAATACATACTTTTACAAA
TATACTAAGAGCCAACTCATGCTCAGGGCAGTTACAAGTTACAGACTCTC
TTAGCATGCTCTTACAGCAGACCAACATTCAGTTATCCCTTATGCATTGA
GAAAGATGGGAATCCCACAAAAAAATAAAAATAAAAATAAAAATAAAAAT
AAAAAGATGAACACTTTTCTTTAGAAGACAACTAGCAACATTTGTCTCCA
CTGCTGCACCATAATAAGGGTGCGCGTACTTTCCGATTATCTTCAAACCC
CGCCCCTAGTCAGTGTAAGCAGGAAACTTCAAGCAATTGTTGAGACACAG
GATTCTCTGATTTCTCAATCACTGGATACAATCAATCTGTCCAAAGCATC
GGAGATATGCCTCATCGTAGGTCTCTTTTCAGGGCTGCTATGAACACAAG
CCATTGCAATCTTTAGAACAGCAATAATCTCTTCTTCCTTATCAGCATCT
GGAGCTAAATATGGATCTAAAACATCTGCAGGCG
back to top