CN185687

Overview
NameCN185687
Unique NameCN185687
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length658
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2498 contig Csv1_Contig2498:1..658. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0001L15_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001L15, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185687 ID=CN185687|Name=CN185687|organism=Citrus sinensis|type=EST|length=658bp
GAGGCTTTCATCTTCATCTACTCCCATTGCCATCCATGACACTCCTGATC
CAATCAGCAGCAGCAATCGGGTCACTAACCTTGTGAAGCCTTCATTCTTT
TCACCCCCATCTGCCTCATCTACATTGATGATGCCTCCTATCTCTTCATC
TGTGCCAACTGCGCCAGCTCTTAATCCTCCCCTAAGTCTGCAACGCCCAT
ATGGAGCTCCAATGCTCCAACCATTTCCCCCACCAACTCCACCTCCATCT
CTAACCCCTAGTTCCGCTCCTCCAATTGATAGACCTCTTATTACCAGAGA
GAAAGTTCGTGATGCACTTCTGATGCTTGTTCAGGATGATCAATTTATCG
ACCAGTTTTATCAAACACTGATGAAGGTGCACCAGTCATGAACACTGTTA
GTCACTTATAACTTTCGTTTGGGGATGTCACCCGGTACTAAAATGCTTGT
AAGATCATCTTCTGTACAGCTCATCAGCCGTAGACCTCTGGAATAATGAC
AGCGTGACGGTTTCTGCTCTAATATTGCCAATGAGAAGTCCCCTTGATTA
TGTGTCAGCGCCTTCTTGAAAGTTCTGAAGGTTGGCCTCACTTGTTTGGC
ATGATGGAACATTTGTAACAGTAGGATGAATAGAATTTAAATCTTTCCAA
TGTTTTTT
back to top