CN185469

Overview
NameCN185469
Unique NameCN185469
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length172
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
CN185469_ssr143 microsatellite CN185469_ssr143:143..152.
Properties
Property NameValue
Genbank descriptionUCRCS05_0001G05_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001G05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185469 ID=CN185469|Name=CN185469|organism=Citrus sinensis|type=EST|length=172bp
AACGGCAACACCATTGCCTCCAAACCCTTTTGGCATAAACCATGGCCACG
GTAGCCTTGAAGCTGAGGTCGAGTTGGTGCCAACCACATCTCAAAAACAA
ACCCTAAATCAATTTCTATCAAGAAATGGAAAAAAAACGGGGGAGAGAGA
GAGGGGATTTTGAAAAAAAGAA
back to top