CN185237

Overview
NameCN185237
Unique NameCN185237
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length588
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN185237_ssr137 microsatellite CN185237_ssr137:137..148. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig2184 contig Csv1_Contig2184:619..1204. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0001A12_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0001A12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185237 ID=CN185237|Name=CN185237|organism=Citrus sinensis|type=EST|length=588bp
TTTCCCTCCCCTTGAATCCCTTGCTTCACATATTACGAAAGAGTACATTG
TCTTTACCGGTACCATTTCTATCTGAGAAGAGGAAACCCTATTTACATTT
TCAAGCAAAAACTTAGGTATAAAACAACCAAACCTGTATATATATATAAA
ATAAAAACTTGGACCTTATTACTACCATCCCGTCCTTTTTCACATTTTGT
CTTATTTTCCACTTTCCTCAATCTTCTATTTTTTGCTGCTTCTATATACA
AACAACTAAAGAAAAACTAGGCAAATGCGTACATTGATCAAACTATTTTG
TATAAGTTGGGTGGATAATAAGATGATAAAACTAAAGTGCCAATAAGTAG
ACCCTAGAATTCTATCAATAATCCCCCCGTTGGAGCTCGGGGAGGGATTC
CCTTTCTTCGCTTGCTGATTCGGTGACTAACAGCAGTTGGAGGGGGTGTT
GAGGGGGAGAAGCTTTGCCTTTTGTTGTCGTTGGTGCTGCTGAAGTCCCT
ATTCTTCAGCTTGCCGTGGATGCCGCTGCTGTATGAATCCTCAGAGCCTG
ATCCCATTGCTAGCCGGTTCTTCCTCTTTTGAAAATTC
back to top