EY659405

Overview
NameEY659405
Unique NameEY659405
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length535
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10313 contig Csv1_Contig10313:1377..1911. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-002-G07-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659405 ID=EY659405|Name=EY659405|organism=Citrus sinensis|type=EST|length=535bp
CCACGCGTCCGGGAGAAGTTGTTGCTTTGCCAGAAAAAACTTTGGTACTC
TTCTAACCAAACCTCTAGTTGATGAATATAGAAATCCTGGTCATGATACG
GCACCTGGAGAACCGAAGCCAATTATATATGATAAATTCATTTGGTAGAA
GCAGAGAAAATCAAAGATCAATACAACGCACAAAGATTAATTTGTGCCAT
AGAAGTCAAGAATCTTAAAATTCAAAATTTGTCAATTGTAGCTATTCAAT
AATATGATTTTGTTAAATTATACAGCATTTTGATATAAATATATTCTTTG
TAAGGTAACGACACCGGGCTGTATTTGTATACCTTTTCTTTGGTCACCCA
CCTTTTATCCCAATTCCCAATCTCTTATTTCCCCTTTTTTTCTTGTTTCT
TTTATATGGTGTAAAACTCATGATCAAATCAGTGGATGTAAGAGTATGTG
GTGAACTTTCAAGTCACATCCTTGATAATTGTAATATTGTGTTAAATGAA
ATTTTCTGCTACTTACTGAAAAAAAAAAAAAAAAA
back to top