CN189125

Overview
NameCN189125
Unique NameCN189125
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length672
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN189125_ssr15 microsatellite CN189125_ssr15:15..24. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig3645 contig Csv1_Contig3645:18..689. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Washington Navel Orange Stored Fruit Rind cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS06_0001F18_r Washington Navel Orange Stored Fruit Rind cDNA Library Citrus sinensis cDNA clone CS_WEc0001F18, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN189125 ID=CN189125|Name=CN189125|organism=Citrus sinensis|type=EST|length=672bp
AGGCTCGCATATTCCTCTCTCTCTGTGTTTTTGCGTTCTGCTCTGTTTTC
ATTTAAGCAGTACCACCGCAGCCAGAAAAGAAAAAAGAAAGGTAAAAAAA
AAAAAAATCGGCCTTGTCCATTATCGTAATCACTCTCGTCTTAGTTCCTC
AAAACTTCTTAATCAAAGAGATAAAGCAGAGCCCAGATCTATCCGCTCAT
CAATTGAATCAACCAAATCAATCAATTATGGCGACTCCGGACATTATGGA
GAGAGAGCAAGACTTACTTCTTTCGCCTCCTCTCCTTGATCCCAGCAAAG
GAGAGGGTGCGAAGTCACGTGGGATGTCGATCGAAAAGAAAATCGAATTT
CTAGAGAGCTTAACCGGAAATGTTAGCAATCGACGGTCTCGAAGGTGGTT
AAATGATCGTTTGTTGATGGAACTTGTTCCACGGTTAGATGCCGATGAAA
TTAGAGGCTTGTTTGCTCCACCACCTTGGGGTGACAAAGTGCCGCCATCA
CCATTTTGTATGACTAACTATGGAGAGTGGGACAAATTCAGGAATATAGA
CATGGATAAAGAGGCTAATATCATTAAAGCCTTAAATGGTTCGACCCTGA
AGAGGAAATGTCATGTTGACACTGATAAGATAGCTGTCTTGAATGCATGG
CGCAGAATCGATTGTCGAACAA
back to top