CN188927

Overview
NameCN188927
Unique NameCN188927
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length150
Libraries
Library NameType
Washington Navel Orange Stored Fruit Rind cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS06_0001A21_r Washington Navel Orange Stored Fruit Rind cDNA Library Citrus sinensis cDNA clone CS_WEc0001A21, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188927 ID=CN188927|Name=CN188927|organism=Citrus sinensis|type=EST|length=150bp
GGAACTCCACTACAAGTATTTCCTTCTTTTCTTGTTTTATACGTTTCTTG
AGACACCTCTTGACACTGTATCATTACTGCCGATTTTTATTGCATTGTTT
ACTGATGATGAGATACCTGAATCGCCAAAAAACCTTGCTGCCTCTTTTAT
back to top