CN188916

Overview
NameCN188916
Unique NameCN188916
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length558
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CN188916_ssr3 microsatellite CN188916_ssr3:3..12. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig375 contig Csv1_Contig375:15..572. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Washington Navel Orange Stored Fruit Rind cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS06_0001A15_r Washington Navel Orange Stored Fruit Rind cDNA Library Citrus sinensis cDNA clone CS_WEc0001A15, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188916 ID=CN188916|Name=CN188916|organism=Citrus sinensis|type=EST|length=558bp
GAAGAGAGAGAGATAGAGAGTATTGGGCTAGTGGCTGGCGCTGAATAAGA
TAGGAGATGTCGATGGCAAAAGACATATACGATCTTCATAATAACGCGGC
AAATTACATGGCACTAACGCCGCTGTGGTTCCTAGATAGAGCGGCTACTG
TGCATCCTACCAGAACTTCCGTGGTCCATGGATCCAAGCGCTACTCGTGG
CTCCGGACATATCAACGCTGCCGTCGTTTGGCCTCCGCACTGTCTATTCG
CTCCATCGGCCTCGGTTGCACGGTAGCAATAATTGCACCAAACATTCCTG
CAATCTATGAGGCTCATTTTGGAGTTCCAATGGCTGGAGCTGTGTTAAAC
GCTGTCAATATTCGTCTAAATGCACCAACTATTGCCTTCCTTCTAGGTCA
TTCAGCTTCTGCTGTAATTATGGTGGACCAGGAGTACTTTACGTTGGCAG
AAGAGGCTTTGAAGATCATGGAAGATAAAAGCAATGGCGGATTTAAGCCT
CCGCTTTTGATCGCGATAGGTGATGAAAGCTGTGATCCTAAGGATCTGAA
ATATGCTT
back to top