CN188817

Overview
NameCN188817
Unique NameCN188817
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length138
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS05_0006N02_f Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0006N02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188817 ID=CN188817|Name=CN188817|organism=Citrus sinensis|type=EST|length=138bp
GGGGTCAATGACATTTATATCGAGCCCCTTTTACAGGTTCACGACAAAAG
GAAATGTTGATGTTCAATACCAAACCCCTACTGGGAACATACTAAAAGAC
CCCTATTATTATAACGACCTTCCTATCACAAATATTAA
back to top