CN188443

Overview
NameCN188443
Unique NameCN188443
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length707
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS05_0006A18_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0006A18, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN188443 ID=CN188443; Name=CN188443; organism=Citrus sinensis; type=EST; length=707bp
CGTTTCCTCTTTTCAATATCAAACGATCCAAACGCAGCTTCTGTGACAGG
ATAATTGAAAATTTGGTGTCGTTTAGGTGCTGAATTTGATGGAGGAGCAT
TCAATTTTTCACAGAATGATCAGTCATCTTCGTTCAACATGCAAGTATTA
CACTGGCTATCCGAAAGATCTTGGGCCATCTCGTGTTATTCATTTCACTT
CAGAGCGTGAATTTGTCCATATCCTTCATCAAGGCTATCCTGTTGTAGTT
GCATTTACTATTAGGGGTAACCTCACCAAACACCTTGACCGAGTACTGGA
AGAAGCTGCAGCTGAGTTTTATCCACATGTAAAATTTATGCGAGTTGAGT
GTCCAAAATATCCTGGATTTTGTTTAACAAGGCAGAGGAAGGAATATCCG
TTCATCGAGATATTTCACAGTCCAGAACAAGCAAGTACCCGAGAAAGGGG
TGCTGATCCAAATATAACAAAATACGCTGTCAAAGTTCTACCCTTCAACT
ACGACCTCAGTGCATATGGATTTCGAGAATATTTCAAACGGCAGGGAATA
AGGTCATCAGATCCCAAGTAAAGTTTGGTATATATATTAGAGAGTCCAGT
CGGCTTCAAATTATATGGATTGAGACAACACTTTGTTTAGGTTGATTATC
ACAGTGCCGTTGCAATAAATCTATAATATGGCCTACGTCCGCACGGTTGA
TGCCCAA
back to top