CK938600

Overview
NameCK938600
Unique NameCK938600
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length411
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1991 contig Csv1_Contig1991:1..411. BLAST: Citrus Unigene V1 Contigs to Trembl
Libraries
Library NameType
Developing fruit albedo at 165 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004440_F10 Developing fruit albedo at 165 DAFB Citrus sinensis cDNA clone A1650001_IF_F10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK938600 ID=CK938600|Name=CK938600|organism=Citrus sinensis|type=EST|length=411bp
GGGGAGGGGAAAGGTTCCATGTGAACGGCACTTGCACATGGGTTAGTCGA
TCCTAAGAGACGGGGGAAGCCCGTCCGACAGCGCCACGGCGCGAGCTTCG
AAAGGGAATCGGGTTAAAATTCCTGAACCGGGACGCGGCGGCTGACGGCA
ACGTTAGGGAGTCCGGAGACGTCGGCGGGGGCCTCGGGAAGAGTTATCTT
TTCTGTTTAACGGCCTGCCCACCCTGGAAACGGCTCAGCCGGAGGTAGGG
TCCAGCGGCCGGAAGAGCACCGCACGTCGCGCGGTGTCCGGTGCGCCCCC
GGCGGCCCTTGAAAATCCGGAGGACCGAGTGCCGCCCGCGCCCGGTCGTA
CTCATAACCGCATCAGGTCTCCAAGGTGAACAGCCTCTGGTCGATGGAAC
AATGTAGGCAA
back to top