CK938580

Overview
NameCK938580
Unique NameCK938580
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length735
Libraries
Library NameType
Developing fruit albedo at 165 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004440_H03 Developing fruit albedo at 165 DAFB Citrus sinensis cDNA clone A1650001_IF_H03 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK938580 ID=CK938580|Name=CK938580|organism=Citrus sinensis|type=EST|length=735bp
GGGCAGCCCTAAAACCAAAACTCGGCATGAGATTGTAAATAATAGTGAGA
GCTTAAGAGTGGAGGCTCAACTTAAGTTTGTAAATAGTAAAATTGAGGGC
CTGAGAATGGAGAATCATTTTGAAGACGAAGGGGATGAGTTTGATTAGAG
GTAATTTCCCTGTTGCCAATTTAATTTTAGGCTCCGTCTGGAATTGACAT
GTAAGGGCTTTCAATACACATCTATTGTGGAATGGAATTCCTTGCTGATG
TTATAAGGGCTGGCAGTAAACATTAGTTAAGTAAAAGTTGGTGTTTATGA
AACACTGGCTGCTGCTCTTCCAAAAATTAAGCTGAAGAGTTACAATCTGG
CTTTTAGATTGCAATACTTCAGTCTATGGTGTCTTAATAGTGAGTGTATG
TCTTGCAGATTTGAGTTGAAGTCCTCGCATTTGTTCTTATTCAGGTGTGC
GGTTATTTATCTCCCTCCCCCCCCCCCCCCCCCTCTCCTGGGAGGGTGAT
TAACAGTGTTTAATACTATGGGGGTGAAAGGACAACGATTGAGGGGGAGT
GGGTTTGACCATGATGAAAATCATCATTCGGAAATTGAAAGTGGGGATAC
CATGTTGTTTGGGTTTTTATCTTCTGGTGACTTTGTAAATAACAGAACAG
GAAAATTACCTTTCCTAATAATCAGTTGTAATATGTAAATAATAGCATTA
CATTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top