CK938365

Overview
NameCK938365
Unique NameCK938365
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length458
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2573 contig Csv1_Contig2573:446..903. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Developing fruit albedo at 165 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004443_G11 Developing fruit albedo at 165 DAFB Citrus sinensis cDNA clone A1650001_IVF_G11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK938365 ID=CK938365|Name=CK938365|organism=Citrus sinensis|type=EST|length=458bp
GGGGGCCAATAACTTGATTACTGAATCAATTCTTTGATTTCACATATAGT
TCTTGCTTCTTGTTTTTCTTCAGCAATTAATATTAACACAGATGGGGCAA
ATTAGCAGCTTAAAGTCAGTCGTGATGGTGTTCGTTTTGGCAGCTTTTGC
AATGGCTGCTGCTTCAGCTCAAAGCACCGAGATGGCCCCCGCACCATCTC
CTTCATTGGACACCGGAGCAGCCTCTTCTCTGCCGGTTTCCGGTGCTGTT
ATTGCATCTTCGCTGTTTGTTTCTCTTCTCGCTCTCCTGAAGCACTAAGT
CGTTTGGTAACGGAAGAAAACTATTACTAGGATATTATTTTCGAGGGTGA
TTGGAGATTAATGTATTGAATTATTTATTTGTTCTTTTCATATTTCATAC
TATTAATGACATAATAATACTTATTCTTTCAAAAAAAAAAAAAAAAAAAA
AAAAAAAA
back to top