CK938361

Overview
NameCK938361
Unique NameCK938361
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length862
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11084 contig Csv1_Contig11084:29..890. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit albedo at 165 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004443_G07 Developing fruit albedo at 165 DAFB Citrus sinensis cDNA clone A1650001_IVF_G07 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK938361 ID=CK938361|Name=CK938361|organism=Citrus sinensis|type=EST|length=862bp
GGGGACAGCACGAAACTTCAGTTGCTTAATTAATTCCTCTTTCTGTTTAG
CAAAGGCGCGATCGCACTTCATGGCCACAGAAAACCTTAAGAAGCGTACT
AGGGATGATCGTAATGACTCAGACGACACTGCCAACGTGGACAAGGACAA
CGAGGTCATCAAAGGTGGCAAACGAAATAATCATCAGAGGAAAATGGTCA
TGGCCAAACGCGGCCTCAAATCACTATCCATGGCAGTGGCTCTCCCTCTT
TCTCTCACTCTCTTAAACATTTACTTCAACGGGTCAAGTGACCGCTACGT
CAAGCAAGAAAAGCCCTTCTGGTTCCCTTCTTTGTTGGTGCTGCATACGG
CCAGCTTGGCTTCAACTTTCTTGATGGGTCTCTCGTCTTGGCTTGTTTGG
GCCGAAGGCGGCTTCCACAAGAAACCCACGGTTTTGTATCTTTGTTTGGC
TCAACTCGGCCTGAGCTTGGCTTGGGATCCCATTGTGTTCCACTTAGGAG
CCTACTGGGCTGGGTTGGTTGTTTCTACGGCTTTGTCTGGGTCTTTGGTT
TGGTACTGTCGAGTGGTCGAGGAGGTGAATCCAATCGCTGGTGATCTGAT
GAAACCTTGTGTGGCCTGGGCTGCGCTCTTGTCCCTCGTTAATCTGAAGC
TCGTCTTTAGCTGAATTTTGGCGGTCAATGAATGCTGTTATGTACTTCTG
TTATAAACAACGACCAAATCAAACTTCACGGTTAATAAGCAGCGAATATT
TCACCGTTATATATAGATAATGCACTACTGAATCTTGTATCAATTTTCAT
TTTTCTTGTTGGATTTGATTTTTACCCTGAAGAGTTACTCTTATATATAG
TGGTTATTTTTT
back to top