CK937426

Overview
NameCK937426
Unique NameCK937426
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length630
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Developing fruit albedo at 80 DAFB in pTriplEx2 vectorcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004780_G11 Developing fruit albedo at 80 DAFB in pTriplEx2 vector Citrus sinensis cDNA clone A80DAB0003_IVF_G11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK937426 ID=CK937426|Name=CK937426|organism=Citrus sinensis|type=EST|length=630bp
GCGGGGTGTCCANNNAAAGTTATGCAAAGAAAGGGAATGAAGTTTTGAAG
GCTGAGCAATTTCTTGAGACCATAATTAAAGCTCCTGAGGAAGAATGGAA
CAAACTTTTGATTGATGGATTGACAGTTGGAAAAGGCGAAATTTTGCCAG
AGGAATTTTATGCTGTCATTAAGAAACGAATTGAGCGGATACTTATCCGA
ACACAGCGCATCCTTACCGAATATGTCAAAGGCATCCAATCAAGAACAGA
GCAGCTTGTACAGTTACTTCGGGGAAATCCTCAATAATCTGTACAGAAAC
GAAGATGCCATTCCACATTACAAGTTACTCTTAATTTGCTATAGCAGAAA
GAAGCTTTTCCTTTGATTGAGAGCGGCTAAATGTAGAACTATGTGCTACC
CTGTTTTGTTCTTCAGCTTTTGTAGCAAAATGTTGCTTGATATGTATATG
CTCCCATGTCAGCTGAAGTATCAGAAAAGCTCGTCACTTCAAACACAGAG
GGATTCTTTGCAGCGGCATTTACTGGGATGTTTGTACATTTCTGATGAAC
TTGTATGTAATCATTCCTTTTATCTTGGGTAATAAATTGGATTATTGCCC
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top