FC921762

Overview
NameFC921762
Unique NameFC921762
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length181
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13854 contig Csv1_Contig13854:3..183. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
RindPdigScdna_library
Properties
Property NameValue
Genbank descriptionC06052A10T7 RindPdigS Citrus sinensis cDNA clone C06052A10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC921762 ID=FC921762|Name=FC921762|organism=Citrus sinensis|type=EST|length=181bp
CGCGGGGGGCACTCATTCTACATCAAACAACACAAAACTTTCTCTGAACA
TCAACCAATTTTCAGCCCAAGAGTTTAAAGCAGAGAACATTCATCACTAA
CCACACTATACAATCCGAATGGCTAAAAGTTTTAAGTCAGTTCGCTTTTA
CTTTGTTCTTCTACTTGTAAGCTCTTCTCTG
back to top