CK936494

Overview
NameCK936494
Unique NameCK936494
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length598
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10147 contig Csv1_Contig10147:931..1523. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit flavedo at 80 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCGF1004521_G09 Developing fruit flavedo at 80 DAFB Citrus sinensis cDNA clone F80DAB0001_IVF_G09 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK936494 ID=CK936494|Name=CK936494|organism=Citrus sinensis|type=EST|length=598bp
GGGGAACAAAGGATCCTTTCCTTAATGCTATATATGATNNNGATCCTTTG
GAGAAAATCTTCTGGGACAGAGTGGTGCTAACAGGAGATGCAGCTCACCC
GACAACTCCACACTCTGCCAGAAGCACAAACATGGCGATAATAGATGCAG
CAGTGTTAGGAAGATGCCTCGAGAAGTGGGGGCCGGATCATTTATACTCT
GCTCTGGAAGAATATGAATCCATTAGGAAGCCTGTAACTTCAGCACAAGT
TCTATATGCGCGACGATTGGGTCAAATGAAACAGGGGTTAAGTATTCCTG
GAAGGGAGCGGCCTTTTGATCCAAAGACAGCAAGTCTAGAGGACTCGGAA
TTCATCGTTAACATAAAAGTGCCTCTTTTCGACGTTGTTCCTCCGATTCT
TGATTCAATTTTTCGTTCTGCTTGATAACTTCAAAGGACACGGCTTGGTC
TGTTCATTATGCTAACTACAGCTGCCTATAAATAAGAGGGTTGACCTCAA
TTGTGTGAGTGAAAGAACTGCTATACTTATGTTCCTTCCTGTAATAACGA
AAGCCTCTTAATTCAGTACAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top