CX046739

Overview
NameCX046739
Unique NameCX046739
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length414
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9585 contig Csv1_Contig9585:154..567. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS07_9H09_b Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-9H09-P17-1-7.b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX046739 ID=CX046739|Name=CX046739|organism=Citrus sinensis|type=EST|length=414bp
ACTTTCGAACTTTGATTCCCGTAAGCAGAGATCTTTCTGATTTGAAGAAC
ATGGAAACCACCTGCGCAGGTAATAACTGGTCAGAGGGTCTTCTGCTTCC
TCCGTTTGGCAGTATTGCTGATGATGATGTCATGAACGACAATCTTGATT
TTCTTAATGTCCCCCAATATGGAAGAAACCCCGACTACATGGGTTAAGTG
CAGCACTGCTTTTTTTTTTTTCTGTTTTGTTTAATTAAATAAATGATAGG
TATACTATTACCTATCAATCATGACAATGTTTTAGTATGGTTTAGTTCAA
CTTATAAGATTTCTTGAGACGTACAAGCAATCTTTTTGTTTACTTTTGAG
CTAAGTATTTTCCTGAAAAAGGAAATAAATCAATAAAAGTTATTGTGTGT
GTCAACAAAAACCT
back to top