CX046727

Overview
NameCX046727
Unique NameCX046727
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length364
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1719 contig Csv1_Contig1719:45..408. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS07_9H03_b Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-9H03-P5-1-7.b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX046727 ID=CX046727|Name=CX046727|organism=Citrus sinensis|type=EST|length=364bp
TTTTTTTTTTTTTTTTTAGCTAGACAAAGAGAATCTCTTGTATATATCAA
GAGATCTTACAAGTTAAACTGAACCAAACTGAGACCATCGTACAATTGAC
GGGTAATAACAGTACCCATACTTTTATTTTCTTAAACATAACATAAGAGA
CTAATACTGCATATTCTTAACCAGTGTGATCAGGGTTTCTTCCATATTGT
GGGACTACAAGAAGATCAATATTTCCATTAATTTCATCATCAGCAATAAG
TGAAAACCATGGGGGGGCCCCACCCTCCGACCAATCGGTATAACCTGCGC
AAGGAGTTCCCATAATCTTCAAATCAGGAAGGCAAAAGATTTCTGCTGGC
TTCGACTGAACCCT
back to top