CX043352

Overview
NameCX043352
Unique NameCX043352
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length331
Properties
Property NameValue
Genbank descriptionUCRCS07_10E06_g Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-10E06-J12-1-6.g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX043352 ID=CX043352; Name=CX043352; organism=Citrus sinensis; type=EST; length=331bp
CTTGAGTACCTCATCGCGACCTCAAAGTTACAAAAAGGAAAAAGGAGGGG
GAAAAAAAAAAAAATAAATAAATAAAGCAATGGGCAAAGGAGAGCTGGTA
AAAGGATTGTTTGAGATTAAGATTATATTAAAGAAGGCTTCTTATCTAAT
GGTAGAGGCTAGAGCTGTGTAGTGTGTACGAGTCTCAAAGAATGTTTTGA
AAGTAATGTTTAGAAAATCGTATTTTTTATTGGCCAGTCAATTTAGTTAC
ACTCTCGCTATTTTGTAATGATGTCTTGGTTGCTACACAGGTTTGAATAA
AAAGACTACAGATTGTTAAAAAAAAAAAAAA
back to top