EY665421

Overview
NameEY665421
Unique NameEY665421
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length962
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionCS00-C1-101-007-G03-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY665421 ID=EY665421|Name=EY665421|organism=Citrus sinensis|type=EST|length=962bp
CTATTAGCTTCTCATTTCCCTCATTCGCCAAAGACAGTTGTGACAATAAG
ACCCTCATTTGCTACGGAGCGATTGAAAGTTCCGGCGCCTTAAGCATCAC
ACCAGGCCCTCCACCAAACCTGCCGATCAGAAAGGTTGGACGGGTTTTAT
ACGGCAAGCCTCTGAGTTTACAGCGATCTTTTATTGATACCACCATCACC
ATTAAGATCTCACGCCATCAGAATTACACTGATCGTGCCGGAGATGGCAT
GACGTTCATTTTTGCAAGCGATAAAAACGGTCCATCAGCAAAGGGCGTCG
GCGAATATCTTGGACTGCAGTCTTCACCAGGCGATAAATTTCCTCCATTA
GCCGTGGAGCTGGACACATGCCTGAACAAGAACCTGATGATCCAAATGAT
AACCCATATTGGCATCGACCTAAACGGAAACGAATCAAATCAAGTTAATA
GTCTGCTTGAACTTGATCTCAAAATGGGACAAACAATCCAGGTTCGAATT
TATTAACATCCAGAACTTTGAACAAATCTCTGGTTTATGGCGGCATATTC
GGGGGAAAACCCTTGTGAAGGGGGGTTAAAAAACCCATTAAACCTGGCCA
AAAATAATTTCCCACCCCCCGCCTTGTTTTGGATTCCAAACCCACCAACG
GGGGGGAATTTTTTAAAAAAGCCCTGGGAGGGTTAAAAAATTTGGACCCT
TTCAACCCCCTTCCCCCCGGGGCCCCCCCTTCCCCCCAAGGGGAAAAAAA
ACCCGGGGGGAGACCCCAAAAAAAATTTTTTTAAAAAACCCCCCCCCTTG
AAAAAAACCCCGGGGGCTCCAAAAAAAAAATTTATAATAAACCAAAAAAA
AAAAAAATTTTAATAAATCCCCCCCCACAAAAAAAAGGAGGGGCAGCTAG
GGGGGGGCCTCCTTTTTTGTCTTTTTTATAAAAAAAAAAAATTTATTGAA
AAAATAAAAAAA
back to top