EY665187

Overview
NameEY665187
Unique NameEY665187
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1030
Properties
Property NameValue
Genbank descriptionCS00-C1-101-083-A07-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY665187 ID=EY665187|Name=EY665187|organism=Citrus sinensis|type=EST|length=1030bp
CCACGCGTCCGATAAGAATGAAAAGTTTCAAGTAGAGATGGAAAACATGA
AACCAGAGAAGGAAGAATTTGACGAAATAGAGTGAGTGGTTTATAAGAAG
CTTTGTTTTATGGGTGATAATGGATAATGCGAAACGTGGAATATGTCTTG
ATGACGCCGTTCTGTTCTGTGCTGGGTTAACAAACTACTCTGTTCTTGGT
TAACAAACTAATCTGTTCTTCTGCTCTTTTTCAATGATGATATTATGGGA
ATTTTAATTTTTGTTTTCTCGGGAGAGAAGGAAAGCTTTTGTTTTTTAAT
TTTTTTTTAGTGGTGTGCTGTTTGGTTTGTGGAAAAACTGAAAAAGGGGG
GTCATTTAGTTTCAGTCCGGTAAGAAAGGTAAAAGGAATTTTTTGATTTT
TGGGTTTTTTATGATCTTAAACTCTTAATTACCCTTTGAGTTGGGAAAAA
TGAGTGTTTAAAATAATTAGATCTTGTTAAAAAAAATGACTTGTTGCTTT
CCTTTAAAAGTTAATTTATTATGAAAAAAAAAAAATTAAATCTTGGTTTG
CTTTCCCAATTATTTGAATTTTGGCAACTTCTAGGTGGGAATTTTATGTT
TTTATGGAGGAAAAATGGGCCTTTCCTTTTTGGAAAAAAAATCTTAAAGG
GTGGGGGGAAAAAAAAAAAACCTTAAAAAAAAGAATTTTTTGCAAGGGGG
GGGGCCTTTTAAAAACCCCTCCTTTTGTTTCCAAAAAATTTTTTTTTTCC
CCAACAGCAAGATTTTTTTTTTTTTTTTATTTTTCCACAGGGGGCCAAAA
TTTTTGGGATTTATATGATAATACATTACAGGAAAGCCGCCCAAAAAAAT
AACAACAATGGAGAGAAGAGGGAGAAAGGCTAATAGTACACCCCCACCAA
TTAAAAATATATTGAGAGGGAATATTTATTTGCCATCTAATGAACTAAAA
ACTGAAGGGCATAACCCGAAATGTAGCGCCGGCACTTTCACAGCGCACCA
TATGATATGCAATTTATCAAAGAGAGAAAG
back to top