EY665186

Overview
NameEY665186
Unique NameEY665186
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length677
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY665186_ssr19 microsatellite EY665186_ssr19:19..33. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-083-A06-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY665186 ID=EY665186|Name=EY665186|organism=Citrus sinensis|type=EST|length=677bp
AGCTGCCTCATTTCGTCCTTGAATTGAATTGAACACGTACATCATCAAGT
ATTGATGGCTTTAGCGTACAATCATTACTCCGATCTTGTTCTTTTCAAAC
AATCAAACGAAGTAAAATTCAAGTGTTTCACGAGTATTAGATGTCAAATA
CAAACGAAAAAACGATGCTTGAGATGCAACACTCTTTATCTTGACAAAGA
TAATTCCCCAACTGCATGCTCCTTCCACGGCCACACAACTGGGGAGAAAG
GGTTGTTTGCCCTGGCGCCACCACACCAAGGGATTGATGGGGAGTGGAGC
GATCACTCTGGGGTGATCGTTTATAAGTGGAATGAAAAGGATGATAGGCC
AAACACTGGAAGTGCTAACTGGAAGAAAAGATGGAACAGCTGTGCTGAAA
ATTGAAAAAAATGCCCCGCCTTGTCGGAAAGGGAGGCATGATTCTTTACG
AGATGGGCTTCCTTTGTACCAGTCCGTGTTTGATTTAATGAGGACGCCAA
ATGGAAAATTCATCGAAAAATAAACAAGGAACTGATTTCTACTAAAATAA
AAAATAAAGGGCGGCCCCTCCTAAAGACCTAGCCTTAGTGAGCGTGGATA
GAAAGCACTATACCTATAAAGAGGAACCTATATATAATCCAGTGGCCACA
TTTTACACCACCTGACGGGGAAAAGGG
back to top