EY665181

Overview
NameEY665181
Unique NameEY665181
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length784
Properties
Property NameValue
Genbank descriptionCS00-C1-101-083-A01-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY665181 ID=EY665181|Name=EY665181|organism=Citrus sinensis|type=EST|length=784bp
AGGTTTAGCATCAAAGGCCGTGTCTATCCTGCCATCCTACCCGTTGAAAA
ACAAACATGTTACCGGCAGGGTCAAAGCAGAGTTCTCTCCTTCCCTTTTG
GCCTTCCGGATTTTATTAATTTTAATAATGGGTTAGGGGGGCTGAATTTC
CTATTTATTTTTTATCATTTAAATAAAAATCTCCACTTTCCTCTGGGCCC
AAATTAAAATTTTTATTGAACATTTTTTTTTGTCCAATACCGGGAGAGGG
GTTGGTTGGAAATTCCTCGAAATCCGGAAATTGGTCTTGGTTCAAAAAAG
GAAATTGGAAAAAATTTTTGAATTACCAAAAGGGACCCCGTAGCGGATGT
TCCCCACTCTCGGGGGAAACATGGCCGAAGAAAGATTACAAATTTTCAAA
AATTTACCGTGAGGGGGAACACAAATAAACATGGTGCCCCACCCCCGGGG
GAGGGGGATATTGGGGGGTATTTTGCGGGGGAGAGGGGAGAGACGACACC
ACCTCCATCAATGAAAAGAAATTTTTTTCTCTAGAAATATAAATCCCACC
ACGGATGATTCGTTGTTAGGAAAAAGAACAAAAGGAGGAATTCCCCTGCC
CACCAAAATATATAATATAACACTTCCGAAACGGGGAGTTGTTTCTCTTG
CTGTATGTAGTTTATATTTGGAGCAACTTTCTTCTTCTTTTTTATTTTTA
TTGTTACCTCTTCCGTCCCAACTAAGAAGGAATGAAGCNGATGGATTGCG
GCATCAATGCTGACGAATANGTGCTTATGAAACG
back to top