EH117785

Overview
NameEH117785
Unique NameEH117785
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length118
Libraries
Library NameType
Different expression profile of FJWC and FJ72-1cdna_library
Properties
Property NameValue
Genbank descriptionfjfw15 Different expression profile of FJWC and FJ72-1 Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH117785 ID=EH117785|Name=EH117785|organism=Citrus sinensis|type=EST|length=118bp
GACTGCGTACCAATTCAAGAAGAGCAGAGCAACATTGTCAGTGACCGAAC
AGTGGAAGATGAGAAATTGGAGAAAAAGCATGGACCCCTGGGATTGACTG
TTACTCAGGACTCATCGT
back to top