EH117774

Overview
NameEH117774
Unique NameEH117774
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length138
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8949 contig Csv1_Contig8949:529..666. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Different expression profile of FJWC and FJ72-1cdna_library
Properties
Property NameValue
Genbank descriptionfjfw3 Different expression profile of FJWC and FJ72-1 Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH117774 ID=EH117774|Name=EH117774|organism=Citrus sinensis|type=EST|length=138bp
GACGATGAGTCCTGAGTAACCATTTTGTCAAAGTCTTTCATTGTCAACTT
GACGGGATGCTGTTTGGGAGGATTGTCCCATGCAATGTAGTGCAGATCAT
GGCTAATAGCAGTGTTGCTGAATTGGTACGCCAGTCTA
back to top