EH117770

Overview
NameEH117770
Unique NameEH117770
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length219
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Libraries
Library NameType
Different expression profile of FJWC and FJ72-1cdna_library
Properties
Property NameValue
Genbank descriptionfjfw33 Different expression profile of FJWC and FJ72-1 Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH117770 ID=EH117770|Name=EH117770|organism=Citrus sinensis|type=EST|length=219bp
GACTGCGTACCAATTCACTCACAATGCAGGGGGATATTGGGGTTGCAAAA
AGTGTTGATAAGGGAGCAACATGGCAGCAATTGGGCATAGCGCTGGATGA
GGACTGGCATCTCTCTTTTCCATATGTTTTCGACTACCATGGCCAAATAT
ACATGATGCCTGAGAGCAGAGCGAAAGGGGAAGTTCGTCTTTATAGAGCA
GTTACTCAGGACTCATCGT
back to top