CX671835

Overview
NameCX671835
Unique NameCX671835
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length934
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5101 contig Csv1_Contig5101:1..934. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS10_13D09_b Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10 Citrus sinensis cDNA clone UCRCS10-13D09-G17-6.b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX671835 ID=CX671835|Name=CX671835|organism=Citrus sinensis|type=EST|length=934bp
TTTTTTTTTTTTTTTTTAATGAAAACTACAGTACAGGCACAAAAATATAT
TCCCATCGAGAAGCTCATTGAGACAGAAAAGATGTAAAGCAAACCACTGG
AAAGACAAAAGTAAATTCCTCTTTTAACCATTGACATATTAAGTGATTTT
GCAGTTACAATCCAGCCAAAACAGAGCTCAGTTTGAAGATACAATCCCGC
CCAAAAAAAAAAATTTAAGTTATAGGAAACTACTAAGAAGATTTCTTGGG
AGGAGACATGTTATGAACGAGGGAAATTGTAGTGCTGACAAGAAATATCT
GTACCGATGATCCGATCAGAACACGTGCAGCTTCAAGAAGTTCAAACTTC
TTTGTTTCCCAGATGCTTGGGTTGTTTATAACCTAAACAATAGATTCATA
TTACAGTCAGAGAGCTTGAGAGAACCGCTACTTAACCTCTGCAACATAAC
TTTTGAGATGAAATGAAAATCATTTTTCTTTAAGCATGCATTCATGCATT
TGTAGTCTTGATGATCCAATTTTCTAATTCCAAACTCAGTAACCATTCTG
AACATATGAGTTGAAGGGGAGCATACTCACCATTGATAAATATATAAAGT
AGATCTATACCCTATTCCCTTCTTTCACAATGATTTCTGGAAATTATAAT
AGTTACAACATTATTAATCCGTGGTGGAAGGAGATATAACATCCAGATTC
TTGGTAGAATTCTATAGGACCTGAAAGGCTTATGTACTCTGTTTATTAGA
AAATAACTCAACTAGCATTAAATAAGTACTGGATTATCCATTTTAGGAAT
TCCAGCATGACAGGATAAGTATTGTATGTTGATAGATAAACCAATCAGGA
AGCTTGTCTGTGCAAAATCCATCACTTCGAAATGCCATCATAAATTAGGC
ATGAATAAACAAATGTGATACCAACTTGCAATGA
back to top