CX671258

Overview
NameCX671258
Unique NameCX671258
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length923
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS10_10A01_b Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10 Citrus sinensis cDNA clone UCRCS10-10A01-A2-6.b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX671258 ID=CX671258|Name=CX671258|organism=Citrus sinensis|type=EST|length=923bp
TTTTTTTTTTTATTGCCGCGCGATTTAAAGCAGGTCGTCGGAAAAGGTCC
CCAATGTTATAAAACAGCAGCTATTGTTTGATATGCTAATCGACATTACA
TATATGCGATCAGGCCTAGATGCATTACCCACTGGCATTCTCAACAGAGA
CATCGTTCTCATCATCAAGACCCTGTCGTATTTTTGCAATCTCAGCCTGT
GCTCTCTCCATAATCTGCCTCTTCTGCATTTCCAGGTCCCTGTGGAAATC
CATCCTCATCTTTTCTAGTTCTAACATCTGCTGCCTCTTACTATTCTCAA
TCTTCTCATATATCTCACTAAATTTGTGAATAGAATCCGCAAGCAATCTA
AACGAGGACCTATCATCAGATTCCCTTCCAATCTTCCTTTTCTTCGGTGG
AAGTCCATCTGAATCATCCTCCTCACCAGCAGTAGATTCTGAATGCCCTG
GACTATCCCTCATCTCATCCACCCCATTTGCACGGTTCAAATATGCCCTA
GGATTCATAAAGACATACTCTCCTGAGTCCATCCCACAAGACAGTCCACC
TTGTTGCTGGGGCGATGACATTAGCATATCCATTTTCTTGAAATAAACCC
ATTTGCTGCCAGTGTCGCCAGTCTCTGCCATCCTAAGCTTCTCCTTCTTA
TATTTCTTCTTTAATGTATACAAACGGTTCCTACACTGTGTGTCTGTCCT
TTCAATCTTGGACACCTCAGATACCTTCTCTGCAACTTCTTGCCATTCCT
CAGATCGAAGACTCTTCCTCCCACGTTGCAGAAACCGGTCACCCCAAGCA
TCTAATAAAACAAATGTTTCATGCTCATTCCCATCGGTAAGTGCATTCCG
CCCACCAGATGAGGGCCTCAGTGCTGGAGTAGCCATAACCGGGGTCGGTA
CTCGAGGAGCAAATTCATAACTT
back to top