EY692329

Overview
NameEY692329
Unique NameEY692329
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length331
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-059-B08-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692329 ID=EY692329; Name=EY692329; organism=Citrus sinensis; type=EST; length=331bp
AGACATTAAGGGTACACAGTATCCTCTCACCGGTTTCTTTATTCCAATAA
ATTTGGATATGGGAGAGTTCTACACAGATTAGCATTTTGTTGTTGACGTT
ACCTTATCTTTTCATATGTGCTGCTTTTATGGAATTTTATTGTTAAGTTT
GTAATTTTGACATTACATATGGTTTAGTAAAAAAATAAAAATCTGTTTCT
TCTATTAAAAATGCAGTTGATTTTAGTTTATTTTTCTGAAGTTGTACTAG
ATTTGAGCTTTGTGAAGCCTCATTTGCTGGTAAAGAAATGAAGAATTAGT
GCTGTTTGGCTAAAAAAAAAAAAAAAAAAAA
back to top