DY257100

Overview
NameDY257100
Unique NameDY257100
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length178
Libraries
Library NameType
AbsCFruitcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAK1AB03FM2 AbsCFruit Citrus sinensis cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257100 ID=DY257100; Name=DY257100; organism=Citrus sinensis; type=EST; length=178bp
CAAAGTCAGGGCACACTAGGGAGTGGTCGCGCATAGCAGCAGATCCTTTG
CTGTTAGCGGTGCTTTAACTTTTAAGTGATGTTGTTACAGTAGCAATTTT
GACTCACTCTAAAGTCTTTGCTGTTGTTTTGATATCAACTGTTATTTACA
ACTTTTAATAGTGCATTTCCATGAAAAA
back to top