DY257097

Overview
NameDY257097
Unique NameDY257097
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length369
Libraries
Library NameType
AbsCFruitcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAK1AA10FM2 AbsCFruit Citrus sinensis cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257097 ID=DY257097; Name=DY257097; organism=Citrus sinensis; type=EST; length=369bp
TATACTATTGCAACGGGGAGGATTACGATGCTGTTGTTGATTCTTCTCCA
AATGAGGATGAGCAGTGGTCATACTGCTATGCTTAGATGTGTATTCTTAG
TATCACCTGTCACCCTATCGAAATGCTTCATCTAATCCTTGAGCTTGTCT
TGTTGCAAGTTTTTATTCCGTAATTTTAATTTCATTGTCTATTTTAATTT
TTAGATTTTCATTGCAAAAGATGGAAGCAGTTGAACGTTGTCTTTTGCAA
TTTTAGTGAAGAAGAGGAGTGATGGGTACTGAATCCGCCCTTTTGTAAAT
TCGGGATCTCATGGCCTCTTTTTATGTCAACATTAGTAGACTTCAATCAG
AGCTTTTAGATTAAACTCA
back to top