CX286781

Overview
NameCX286781
Unique NameCX286781
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length379
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX286781_ssr164 microsatellite CX286781_ssr164:164..178.
CX286781_ssr144 microsatellite CX286781_ssr144:144..159.
Properties
Property NameValue
Genbank descriptionC01001A01Rv Veg1 Citrus clementina cDNA clone C01001A01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286781 ID=CX286781|Name=CX286781|organism=Citrus clementina|type=EST|length=379bp
GCATCGCCCCCCTTATAACTGTATAAGTGGTTTCCGACGTTCCCGATGCT
ACTTTGTATGCTGGCTATTCTTGATGGAAACTCAACCCTTCCATTTTGAT
GGTCTTGACACCAACAAAAGAAGACTGCCTCAACATAATTTACTATTTAT
TTATTTATTATTATTGTTGTTGTTGTTGGTTTTAAATTAGTCGAAAGGTA
GTGCCCATCTTATTTCGTGGAGTGATGGGTAGAATCACTGAGCATGATGC
AAGAACAGACTTAATGGTTGCAATTTCTTACATTTGTGGTCCTAAGCTAA
GGTGGCGTTTGTTTTTTTGTCTGAAATCTGAATAGACCTGAATTAGTCTG
AAAAAAAAAAAAAAAAGGGGGGGCCCGGT
back to top