CX286788

Overview
NameCX286788
Unique NameCX286788
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length466
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC01001A08Rv Veg1 Citrus clementina cDNA clone C01001A08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286788 ID=CX286788|Name=CX286788|organism=Citrus clementina|type=EST|length=466bp
GAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTTTCTATTTGAAACAAA
ATTATTAAGAATATCTAAAACTAGTTCATCATACTTTTTTATGCCCGTGG
TACAATGACAAGTAAAAAAATAGTTGAGTTTACAACATTTTCTAATTGGT
AATGTGGGCTGGCTAAAACATGACCGAACCAAAACATCAAGCCCAGCTAT
ATTTACTTGCTACAACTATGATCTTGAATCTTGAATCTCATGGTATGATC
TTCATCTCTCTCAATTTGCCGACCCACATTCTAATACTCTTCATGGTATC
AACAAACCCAAAGAACCCAAATTCTCTGCTCTTGTTCATGCTACTGACAT
GCTGAAACTCAAAATGCAAGACGAGTTTCATTGCCTCAAAACAAGTTATC
TCCTCCAATTTGGTCTTATACAGCCCATGTTTCTCAACTATCTCATCCCA
TATTTCTCCTTTCTCT
back to top