CX286790

Overview
NameCX286790
Unique NameCX286790
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length550
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig1 contig Ccv1_Contig1:1..550. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC01001A10Rv Veg1 Citrus clementina cDNA clone C01001A10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286790 ID=CX286790|Name=CX286790|organism=Citrus clementina|type=EST|length=550bp
TTTCTATGCTAGCTGCCAGTTTTATTTTCTTTCTTGGGTTATCCTTACCA
AAGTCTGTGAAAACTTTAAATGAACAGATTGAGATTATTTCAGTAGCTAT
TTGAATTTTCTGTTAATTGACCAACTTTATTACTGTTATTATTTTTGTTT
TCACTTTTTCGAAATAGTCATACCAGAGTTCGTAGGTATTAATTTCTTCA
CCTTTAATAGTAAAGGGAATTAGTAGCAATTGGACATTTCATAAAATGCA
GAACATTGGCCTGTCTATTTTTTTCTCGAGTGGGTTTCTAGTTATGATAT
TTGTTGCTAGTGCAATTTGTGTGTGGAAATCTGTTGTGCTTTTAGAGTGT
GTGTTTGTTTGCATGTGTTTTTGTATGAATTTTGCAGTCAGGGACTCTGT
GACTGCTGCACATCCAGAGTAGCAAATGCTGAAAATTTCATGCTTCTGAG
TTGGGTTTTGTTTTCTTCACACTTACCTCTTTTTGTTTTTTCCCCTCTCT
CCCCTCTCTCTAAATCATAAATGAAAATTAGCACTGTTCTTACACATTGT
back to top