CX286795

Overview
NameCX286795
Unique NameCX286795
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length575
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15374 contig Ccv1_Contig15374:54..628. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01001B04Rv Veg1 Citrus clementina cDNA clone C01001B04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286795 ID=CX286795|Name=CX286795|organism=Citrus clementina|type=EST|length=575bp
TGGGTCTTGGCCATTCTCCCCTATCCTTATCCCAAGTCATAAATGGCTTC
TGCCAAAGGCACATGGATCAAGGTTTGCTTTTATTACTCTTTCCATATTC
TGCTCTGATATTATTTTCTGCAGACCCAACCGAATTATCTATAATTGGTT
GGTTGTCTATTTTGATTATCGTTCAACTGCCGCTGCTGGATAATTATTAC
AGGTAGTGGGTTTGGTTTTCTTCATTCCGTTTAGGGAATGCTTGTAAATT
TCTTGGAAGCCTGCCTATCTAAAAGTCATCAAGAGTTAATGGAGAGTCAA
TTCTTAATTCATTTACAGATCATTTTGATTTCTTCAAAATGGAAAATGAC
AAAATTATTTGGTTTGCTGACACGCGATCGAGAATGGTTTTTATTATCCC
AAATTGACTACAAATCAGTCAATTTTGTACATGTAGTTGTTCAATATTAG
CATTTTTGGTTGTGATCTTCGTTTTTCAGCTTGACCAAAAGGGTTCCGGG
CCTGGAGCCAGAAGCTCGCATGCAATTACCATAGTAGGACAAAAGGTCTA
TGCTTTCGGGGGCGAGTTCACACCA
back to top