CX286798

Overview
NameCX286798
Unique NameCX286798
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length606
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig12166 contig Ccv1_Contig12166:170..775. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01001B07Rv Veg1 Citrus clementina cDNA clone C01001B07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286798 ID=CX286798|Name=CX286798|organism=Citrus clementina|type=EST|length=606bp
GTTCCTCCAAGAGCACTGAACAAGATGCACCACCAGCGGAGGCTTTACCC
GCTGTCAATGTGAATCCTCTAGATACTAACACTGTTTCAGATGTTAAAAA
CCTTGAATCACATTCGACTCCTCTTCAAGAACCACCTTCAATTTCTTTAG
ATGTTCTTGGAGATACAAGTTCAGCTGATCCTGATATTCAACCATCTGCA
TATGCTAGTGTCAAAGCTAAAACGCTTGAAGTTCCTAATACTATAGAAGA
CACCACTGCTGAGACTGATACCATTCTTTCCTCAAACTCTGAACTCCCTG
AATCTTCCAAGGTGGAAGCCCCTGACAATTCCCCTGTAGAATCCAAGGCT
GGACATGCTGCAGCTTCAAAGGCAGAAGCCTCCACAGCTGAACCCCATGC
AGATTCTATAGCTGAACTCCCTGCAGAGTCCGAGGCCAAACCTTCTTTCA
AAGTACAAGCCGCTACTCCTAACCGTAATGCAGCTCCTTCTGACACAGAG
CTTAAGAATGTAAATGACACAGAAATCAAAGATAAGGTTAACAAATCGGA
GTTACCTACACTACCAATGAATGAGAAGTCCAACTCAGCACAGTTATTTC
TTTTGG
back to top