CX286932

Overview
NameCX286932
Unique NameCX286932
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length163
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9299 contig Ccv1_Contig9299:330..492. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC01002F10Rv Veg1 Citrus clementina cDNA clone C01002F10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286932 ID=CX286932|Name=CX286932|organism=Citrus clementina|type=EST|length=163bp
TAAGAATGTTAGAATTTATTTCCGCCTACAATACAAGAGTTCAGTCCTAT
TCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCTTGGGGG
GGGGCCCGGTACC
back to top