CX286956

Overview
NameCX286956
Unique NameCX286956
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length553
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10266 contig Ccv1_Contig10266:358..910. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01003A02SK Veg1 Citrus clementina cDNA clone C01003A02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286956 ID=CX286956|Name=CX286956|organism=Citrus clementina|type=EST|length=553bp
GAAGATGTTGAAACTTACCTGTAGGGACTCCTAACATGGGGTTGGAGATG
TTAATGAACATGTTTGGTGGACTTGGGGCGGGCAGCCTAGCTGTTCCTAA
CAGATCTGATGTGCCTCCAGAGCAATTATATGCCACCCAGTTGTCACAAC
TTCAAGAAATGGGTTTCTTTGATACACAAGAAAATATTCGGGCTTTAATT
GCAACTGCTGGAAATGTCCATGCTGCAGTGGAGCGACTCTTGGGGAATTC
TGGTCAGTAGGTTGCTATCAATGTTTAATATCACCTGGTTAGTGCCGTGA
TAAGGACTGGTGGGGATCAATCGGTTGAACTGGAGTCATATTCAAAGCCC
ATTTTGGGTATGAATAATTTTAGTTATATATCATAGTAAGGGCTGAAAAC
TTGTCTGTGTACTTGCTCTCTTTCTAGAGAGTTCTGTCGGACCTGAGTGT
CACTGTACATACTCGGTATTAAGATTTGTCATATGAATTGTTTGGAAAAT
TTATTATCTTAAGGAATGCATGACATTTTTTTATGAAAAAAAAAAAAAAA
AAA
back to top