CX287088

Overview
NameCX287088
Unique NameCX287088
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length437
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC01004E10SK Veg1 Citrus clementina cDNA clone C01004E10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX287088 ID=CX287088|Name=CX287088|organism=Citrus clementina|type=EST|length=437bp
ACAAAAGCATGCCTATTGGGAAAGGCTGTAACCTGCAGATACCTTAGACA
AGATAATTTCCTGGAGATTGATGTGGATATTGGATCATCATCTGTGGCCA
GGAGTGTCATTGGCCTTGTCCTTGGATATGTAACAAGCCTAGTTGTCGAT
CTAGCAATTTTAATAGAGGCAAAGGAGGAGGAAGAACTACCTGAGTATAT
ACTTGGGACTGTTCAACTGAATCGTGTGAGGCTTGATGCTGCCGTACCAT
TGGGGGTTTGAGGATTCTTTCAAATACTTGTTCAACACAGCATTGTTATA
ACCTTAACTGTACTCCTATTTTGCTGATGATTGGCCTAGTGTACATTTGC
TTCCCATATACGGATCTGAGTTGCAAATTTTAGTTCTGTGAATAAACAGC
TTTACTGTACATTGATCAGAGTTGCACATTACTTTTT
back to top